Sep 14

I Kan’t SEE a Thing

Resently, the SEE key on my MakBook stopped working. This is annoying, but it kould have been worse. As you kan see, a ‘k’ or an ‘s’ is easily substituted, and for more formal kommuniation, I have taken to kopying and pasting the letter SEE. …

Word Play

2 min read

Aug 17

Alphabet Story

An apple always appreciates anything advertised as “Astronomical!” Bees basically break beauty basics because bees behave badly. Can cream cheese cure cancer? Definitely don’t do Daddy’s dirty deeds. Every enchanted egg entering elementary education eventually earns enlightenment. Finnegan freezes fish farts for fun. Great God girl! Granny’s grown gigantic gonads! …

Poem

1 min read

Jul 7

Thomas Hovering

The GPS monitor dug into his ankle and it hurt, all day. Thomas figured out a way to fall asleep with it, but by morning the black metal box with its flashing red and green lights had twisted around and it felt like someone had spent the night quietly sawing…

Flash Fiction

3 min read

Jun 7

Words Made into a Poem and into New Words

Commitment Before I can commit, I’ve gotta know: Are you one of those people who die? You know the type - They’re alive, doing things and then one day something happens And they die. Because if you’re going to just die What’s the point in doing anything with you? I mean, I won’t be able to reminisce…

Poetry

2 min read

Words Made into a Poem and into New Words

Jun 2

Epiphyte

Hi. My role models are epiphytes. You know, those plants that grow without soil. They just absorb sunlight, moisture from the air and they don’t really bother anybody. They give us oxygen. And they hurt no one. The rest of us do harm just by existing. We kill & eat…

Ahisma

1 min read

May 30

How to Build a Treadmill Desk — the Series

I made an educational video called How to Build a Treadmill Desk. It has received over 20,000 views, which may not be viral, but maybe it qualifies as some sort of minor infection. Perhaps a blister. It’s gone blisterous. I followed the video with two more pieces that delve into the complex and rewarding world of making treadmill desks. Here are links to all three! Feel free to follow my Youtube channel: @DaisybrainVideo. And for more from me, including more video channels, see Eric Indiana on Linktree. Also, I would really appreciate a follow for this blog!

Treadmill Desk

1 min read

How to Build a Treadmill Desk — the Series

I made an educational video called How to Build a Treadmill Desk. It has received over 20,000 views, which may not be viral, but maybe it qualifies as some sort of minor infection. Perhaps a blister. It’s gone blisterous. I followed the video with two more pieces that delve into the complex and rewarding world of making treadmill desks. Here are links to all three!

Feel free to follow my Youtube channel: @DaisybrainVideo. And for more from me, including more video channels, see Eric Indiana on Linktree. Also, I would really appreciate a follow for this blog!

May 10

Exclamation Points are Only the Beginning!

Why stop at exclamation points when there are so many more possibilities? Like … Expiration point: ⚘ You have to use this one quickly because it expires. Use it in sentences such as: “The bread will soon be too moldy to eat⚘” or “We only have a few summers left…

Jokes

2 min read

Exclamation Points are Only the Beginning!

Apr 30

Self Help Books That Have Yet to be Written

I have checked, and Google returns zero results for the promising titles of these self-help books, which you are now free to write & make a million dollars: “How to Make Your House Ugly” “Surgical Enhancements to Your Organs” “How to Write Silent Music” “How to Embezzle From the Police…

Jokes

1 min read

Self Help Books That Have Yet to be Written

Apr 28

If You Follow Me, I Will Follow Back

Let’s all get paid. My apologies to those followers who are getting this in their mailbox — it’s just that Medium only pays writers who have over 100 followers & I deserve to be paid my $1.25 or so a month. Thanks!!! FOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOW

100 Followerschallenge

1 min read

If You Follow Me, I Will Follow Back

Let’s all get paid.

My apologies to those followers who are getting this in their mailbox — it’s just that Medium only pays writers who have over 100 followers & I deserve to be paid my $1.25 or so a month.

Thanks!!!

FOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOW

Apr 25

Oopsy Daisybrain

When people say, “Now, then,” are they just trying to cover all bases? Why don’t they say, “Here, there”? “Eric” doesn’t convey much information. From now on, I will go by my entire genetic sequence. You can call me GACTCATAGATAGGACACAGATATATAGATAGATAGACACACAGATGATAGATAGATTTAGAGACAGACAGACAGATAGACGATAGACGATGACAGATGACCAGATATATAGATAGATAGACACACAGATGACAGATATATAGATAGATAGACACACAGATGACAGATATATAGATAGATAGACACACAGATGA for short.

Humor

2 min read