Jun 7

Words Made into a Poem and into New Words

Commitment Before I can commit, I’ve gotta know: Are you one of those people who die? You know the type - They’re alive, doing things and then one day something happens And they die. Because if you’re going to just die What’s the point in doing anything with you? I mean, I won’t be able to reminisce…

Poetry

2 min read

Words Made into a Poem and into New Words

Jun 2

Epiphyte

Hi. My role models are epiphytes. You know, those plants that grow without soil. They just absorb sunlight, moisture from the air and they don’t really bother anybody. They give us oxygen. And they hurt no one. The rest of us do harm just by existing. We kill & eat…

Ahisma

1 min read

May 30

How to Build a Treadmill Desk — the Series

I made an educational video called How to Build a Treadmill Desk. It has received over 20,000 views, which may not be viral, but maybe it qualifies as some sort of minor infection. Perhaps a blister. It’s gone blisterous. I followed the video with two more pieces that delve into the complex and rewarding world of making treadmill desks. Here are links to all three! Feel free to follow my Youtube channel: @DaisybrainVideo. And for more from me, including more video channels, see Eric Indiana on Linktree. Also, I would really appreciate a follow for this blog!

Treadmill Desk

1 min read

How to Build a Treadmill Desk — the Series

I made an educational video called How to Build a Treadmill Desk. It has received over 20,000 views, which may not be viral, but maybe it qualifies as some sort of minor infection. Perhaps a blister. It’s gone blisterous. I followed the video with two more pieces that delve into the complex and rewarding world of making treadmill desks. Here are links to all three!

Feel free to follow my Youtube channel: @DaisybrainVideo. And for more from me, including more video channels, see Eric Indiana on Linktree. Also, I would really appreciate a follow for this blog!

May 10

Exclamation Points are Only the Beginning!

Why stop at exclamation points when there are so many more possibilities? Like … Expiration point: ⚘ You have to use this one quickly because it expires. Use it in sentences such as: “The bread will soon be too moldy to eat⚘” or “We only have a few summers left…

Jokes

2 min read

Exclamation Points are Only the Beginning!

Apr 30

Self Help Books That Have Yet to be Written

I have checked, and Google returns zero results for the promising titles of these self-help books, which you are now free to write & make a million dollars: “How to Make Your House Ugly” “Surgical Enhancements to Your Organs” “How to Write Silent Music” “How to Embezzle From the Police…

Jokes

1 min read

Self Help Books That Have Yet to be Written

Apr 28

If You Follow Me, I Will Follow Back

Let’s all get paid. My apologies to those followers who are getting this in their mailbox — it’s just that Medium only pays writers who have over 100 followers & I deserve to be paid my $1.25 or so a month. Thanks!!! FOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOW

100 Followerschallenge

1 min read

If You Follow Me, I Will Follow Back

Let’s all get paid.

My apologies to those followers who are getting this in their mailbox — it’s just that Medium only pays writers who have over 100 followers & I deserve to be paid my $1.25 or so a month.

Thanks!!!

FOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOWFORFOLLOW

Apr 25

Oopsy Daisybrain

When people say, “Now, then,” are they just trying to cover all bases? Why don’t they say, “Here, there”? “Eric” doesn’t convey much information. From now on, I will go by my entire genetic sequence. You can call me GACTCATAGATAGGACACAGATATATAGATAGATAGACACACAGATGATAGATAGATTTAGAGACAGACAGACAGATAGACGATAGACGATGACAGATGACCAGATATATAGATAGATAGACACACAGATGACAGATATATAGATAGATAGACACACAGATGACAGATATATAGATAGATAGACACACAGATGA for short.

Humor

2 min read

Apr 19

Finally, Some Poems by a Non-Poet!

The Ways We Love The ways we love Are surface ripples What is underneath? I don’t know myself I don’t know my self How the Sailor Landed The old sailor ceased to seize the seas She waved the waves goodbye For her, the current was no longer current The swells…

Palindromes

1 min read

Apr 4

Heretofore Unknown Science

“Reverse Image” vs. “True View” Mirrors Imagine a world in which a “mirror image” was not reversed. Rather, it presented your appearance in the same orientation as others saw you. Your reflection in your bathroom mirror would function like a video image taken of you, and you would have a…

Science

4 min read

Mar 26

The Difference between TV and Real Life

…and Suggestions for Business Names On tv, presents come with lids and boxes wrapped separately for quick mess-free opening. On tv, people don’t say “bye” when they hang up the phone; they just both know when the conversation is over because they’ve read the script. On old TV shows, family…

Puns

2 min read